La huella genetica en Medicina Legal. ADN con fines forenses
Autor: Dr. Ricardo Rodriguez Jorge | Publicado:  3/09/2007 | Medicina Forense y Legal , Genetica | |
La huella genetica en Medicina Legal. ADN con fines forenses.

Dr. Ricardo Rodríguez Jorge, Dr. José Alberto Borges López.

Resumen.


La identificación en Medicina Legal tiene unas consecuencias inmediatas sobre el individuo que no aparecen en otros campos de la ciencia. La identificación en el contexto médico-forense nos identifica al individuo, pero también a parte de sus circunstancias, ya que, al margen de su participación o no en los hechos nos relaciona a la persona con unos determinados sucesos criminales, lo cual puede acarrearle una serie de consecuencias sociales que en ocasiones pueden ser difícilmente reparables y justificables.

Introducción.

En la década del 50 fue descubierto por los científicos Whatson y Crick la molécula de ADN, dicha hazaña científica revolucionó el campo de la medicina específicamente la especialidad genética, a partir de ahí se comenzaron múltiples intentos de modificar enfermedades que hasta entonces solo tenía tratamiento paliativo y no se podían prever, es importante señalar que precisamente la parte de la molécula de ADN que se utiliza con fines clínicos es la no variable ya que es la que consta con aminoácidos que codifican a cada gen en cada tejido, sin embargo no fue hasta 1985 que Dr Alec Jeffreys para la resolución de un caso de inmigración de un joven procedente de Ghana lo aplica con fines forenses por primera vez y en segunda ocasión dos años más tarde, en la investigación criminal, posibilitando identificar a Robert Melias, un peón de Bristol de 32 años de edad, como autor de una agresión sexual a una mujer enferma de polio, y a Nigel Davis como autor del denominado "caso del condado de Leicestershire", en el que se produjo la violación y muerte de dos mujeres del condado, la primera en 1983 y la segunda en 1985 y donde los métodos serológicos clásicos no pudieron lograr una individualización suficiente con los indicios biológicos, su teoría se basba en el decubrimiento de regiones hipervariable que se extendían entre las codificantes, que no se repiten entre los individuos y que cada ciertos segmentos vuelven de forma exacta a la misma secuencia de aminoácidos que presentó al principio lo que hacen identificar de forma absoluta a ese individuo.

La variabilidad de estas zonas radica en diferencias exhibidas por el material genético, en la secuencia nucleotídica misma a través de sustituciones de nucleótidos, o en la distinta longitud generada por una misma secuencia que se repite un número diferente de veces. Cuando fue posible conocer su localización y desarrollar una metodología adecuada para ponerlas de manifiesto comenzaron a ser estudiadas mediante sistemas de análisis cada vez más precisos y sencillos.

El descubrimiento de regiones hipervariables del genoma con localización específica permitió el desarrollo de las sondas de locus único que resolverían el problema, posibilitando el estudio de una zona conocida del genoma que se visualizaba como dos únicas bandas para la condición heterocigota, correspondientes cada una a un alelo, heredado de cada progenitor.

Estas zonas están constituidas por secuencias repetidas, que aparentemente carecen de función como codificantes de proteínas. La menor variabilidad exhibida por estos sistemas de análisis se solucionaba empleando un conjunto de cuatro o más sondas unilocus que evaluaban otras tantas regiones del genoma.

Sin embargo, aún persistía un inconveniente para el empleo masivo de estas metodologías en la práctica forense: las sondas multilocus, y en menor medida las unilocus, requerían un ADN en estado óptimo en cuanto a su integridad, de alto peso molecular, lo cual rara vez ocurre en cadáveres en proceso de descomposición, o en manchas antiguas de fluídos biológicos o expuestas a condiciones ambientales adversas. La solución llegó con el desarrollo de técnicas de amplificación o "copiado" de porciones de ADN mediante la reacción en cadena de la polimerasa (PCR), con las cuales fue posible implementar sistemas de análisis de secuencias más pequeñas ("microsatélites" o "STRs"), pero menos variables que las anteriores. Con el advenimiento de esta nueva técnica, se hizo posible la evaluación de polimorfismos en cuanto a la secuencia nucleotídica de la región variable, además de las diferencias de longitud. Los marcadores de identificación para un locus establecido permite -de acuerdo con la probabilidad estadística de ocurrencia- establecer las relaciones filiatorias, en la medida en que se constata su presencia en el genoma de cada uno de los individuos testeados.

La permanente innovación metodológica exige la actualización y perfeccionamiento de los sistemas validados por la comunidad forense internacional, que cuenta al presente con la posibilidad de evaluar un centenar de regiones variables del genoma.

Bases Genéticas.

El ADN es un polinucleótido constituido por dos cadenas antiparalelas de unidades de desoxirribonucleótidos unidos covalentemente, dispuestos de una forma complementaria y adoptando una estructura enrollada de doble hélice dextrógira. Las bases que forma los nucleótidos son la adenina (A), guanina (G), citosina (C) y timina (T).

Su estructura fue descubierta por James WATSON y Francis CRICK en 1953, lo cual permitió afrontar su estudio de forma directa, evitando los dificultosos y complejos caminos indirectos que se habían utilizado hasta entonces.

Basándonos en la función del ADN podemos dividirlo en dos grandes grupos:

ADN CODIFICANTE

Es el encargado de almacenar la información genética en los genes, que son los diferentes sectores de ADN con un orden concreto en la disposición de los nucleótidos que determina la secuencia de aminoácidos de las proteínas que codifican y el grado de expresión del gen en cada tejido y en cada tiempo. Esta función del ADN se corresponde con la idea generalizada que se tiene sobre el mismo.

ADN NO CODIFICANTE.


No obstante, existe otra parte del ADN cuya función específica es desconocida en la actualidad, aunque se sabe que no guarda información genética y que juega un importante papel en la estructura y en la función de los cromosomas y, sobre todo, actuando como puntos calientes de recombinación.

La identificación médico-legal a través del análisis del ADN se realiza sobre regiones no codificantes del genoma, es decir, aquellas que no contienen información alguna sobre las características fenotípicas de las personas. Es decir, que por medio del análisis forense del ADN no se puede saber sin un individuo es rubio, alto, gordo,... ni conocer si va a sufrir alguna enfermedad o si tiene tendencia a padecer determinados tipos de patologías, ya que el ADN no codificante no contiene esa información. Es cierto que si disponemos un archivo con material biológico (sangre o saliva) la muestra podría destinarse a otro tipo de análisis, diferente a la identificación médico-legal, pero también es cierto que las muestras archivadas en esas bases de datos, al margen de las garantías que el sistema de cada país disponga para evitar el mal uso, no podrán ser utilizadas en otros estudios clínicos por la cantidad de material (que es mínima, suficiente para el estudio forense, pero difícilmente para un análisis clínico) y por las condiciones y características del mismo, ya que este se guardan en forma de manchas secas, con lo cual la calidad del ADN se verá afectada.

Las características generales del ADN no codificante lo hacen especialmente útil para su aplicación a la identificación en Medicina Forense. Como se puede deducir de su trascendente función, el ADN esencial está formado por secuencias altamente conservadas con muy pocas variaciones interindividuales e intergeneracionales, ya que de lo contrario se podrían ver afectadas funciones básicas para la vida de las personas. Los mínimos cambios que tienen lugar, cuando son viables, aumentan el polimorfismo de proteínas y enzimas, aunque también pueden tener efectos negativos.

Por el contrario, el ADN no codificante presenta una gran variabilidad de unos individuos a otros, ya que estas secuencia no son conservadoras al no afectar sus cambios a la fisiología del individuo. Las variaciones debidas a cambios de bases sencillos, procesos de inserción-delección o de intercambio de ADN (recombinación) durante la formación de las células germinales (meiosis), hacen que se modifiquen el número de repeticiones o el orden de las bases de un determinado fragmento repetitivo, pudiendo producirse en un locus sencillo o e múltiples loci, siendo este el origen de la variación que hace que no haya dos personas, a excepción de los gemelos univitelinos, que tengan la misma secuencia del ADN.

La repercusión práctica de lo anterior es la existencia de diferentes alelos, es decir la posibilidad de que encontremos entre la población varias formas de presentarse un determinado carácter o fragmento de ADN no codificante.

No obstante, existe otra parte del ADN cuya función específica es desconocida en la actualidad, aunque se sabe que no guarda información genética y que juega un importante papel en la estructura y en la función de los cromosomas y, sobre todo, actuando como puntos calientes de recombinación.

Este ADN puede ser de dos tipos: ADN espaciador, el cual está formado por una secuencia sencilla de bases que se dispone entre regiones codificantes del genoma; y ADN repetitivo, que lo forma una secuencia que, al contrario que el espaciador, se dispone por todo el genoma debido a la existencia de múltiples copias. A su vez este ADN repetitivo se divide según las características de la secuencia en "Secuencias repetidas en tándem", en las que existe una secuencia común relativamente corta que se repite en tándem de manera continua (una tras otra) en un fragmento de ADN ---- ATCGG ATCGG ATCGG ATCGG ATCGG ---- y "Secuencias repetidas intercaladas", tratándose de una secuencia larga de bases que aparece repetida, pero no a continuación del primer grupo de secuencia repetitivo, sino en un lugar diferente y distante del genoma:

ATCCCCGGGAATCGATAAACGGATC ---------------------ATCCCCGGGAATCGATAAACGGATC

Las características generales del ADN no codificante lo hacen especialmente útil para su aplicación a la identificación en Medicina Forense. Como se puede deducir de su trascendente función, el ADN esencial está formado por secuencias altamente conservadas con muy pocas variaciones interindividuales e intergeneracionales, ya que de lo contrario se podrían ver afectadas funciones básicas para la vida de las personas. Los mínimos cambios que tienen lugar, cuando son viables, aumentan el polimorfismo de proteínas y enzimas, aunque también pueden tener efectos negativos.

Por el contrario, el ADN no codificante presenta una gran variabilidad de unos individuos a otros, ya que estas secuencia no son conservadoras al no afectar sus cambios a la fisiología del individuo. Las variaciones debidas a cambios de bases sencillos, procesos de inserción-delección o de intercambio de ADN (recombinación) durante la formación de las células germinales (meiosis), hacen que se modifiquen el número de repeticiones o el orden de las bases de un determinado fragmento repetitivo, pudiendo producirse en un locus sencillo o e múltiples loci, siendo este el origen de la variación que hace que no haya dos personas, a excepción de los gemelos univitelinos, que tengan la misma secuencia del ADN.

La repercusión práctica de lo anterior es la existencia de diferentes alelos, es decir la posibilidad de que encontremos entre la población varias formas de presentarse un determinado carácter o fragmento de ADN no codificante.

Metodología para el trabajo con los indicios o evidencias.

Recuperación y limpieza del material


Lo esencial en la recuperación del material es minimizar la contaminación de las muestras con DNA extraño. Se debe poner especial cuidado con cada elemento que se encuentre en el lugar del hecho, y las personas que llegan primero al mismo, gotas de sudor, sangre, saliva, células epiteliales o cabellos de todos los que analizan el sitio o llegaron a él, deben tener total cuidado, porque pueden ser agentes contaminantes e invalidar las pruebas o los resultados devueltos por los laboratorios.

Por elemental que parezca, no debemos olvidar nunca que los laboratorios sólo estudian aquello que se remite, y que el análisis se inicia sobre el indicio en las condiciones en las que llega, no en las que se manda; de ahí la enorme importancia del indicio en el lugar de los hechos.

Durante la recolección, conservación y envío, debe evitarse la contaminación, ya que cualquier material orgánico procedente de los manipuladores o ruptura de la cadena de frío puede imposibilitar el estudio.

Normas generales

En este sentido deben seguirse las siguientes normas generales:

1.- Procurar condiciones de máxima esterilidad, usando guantes de goma -si se entra en la escena del crimen- e instrumentos esterilizados o adecuadamente limpiados para la obtención de materiales (pinzas, tijeras etc.).
2.- Volver a limpiar o utilizar un nuevo instrumento para recoger un indicio diferente. Si se recoge con guantes, cambiar los mismos si se recoge un elemento diferente.
3.- Usar diferentes recipientes para cada indicio, aunque hayan sido recogidos en lugares muy próximos o estuviesen juntos.
4.- Etiquetar perfectamente cada uno de los recipientes haciendo referencia a:
a. fecha y hora;
b. identificación de la víctima;
c. localización del indicio;
d. tipo de indicio;
e. número del mismo;
f. nombre de la persona que lo recoge;
g. referencia al caso judicial.
5.- Enviar lo más rápidamente posible al Juzgado o laboratorio, asegurando que si hay muestras con cadena de frío, esta se mantenga.
6.- Es fundamental y básico tomar muestras testigo de la víctima y sospechoso. De ser posible extrayéndole sangre, o en su defecto con frotis de la cavidad bucal (siempre con autorización de la persona implicada).
7.- Tomar la filiación de todas las personas que han intervenido o colaborado en la recogida de las evidencias por si se produce algún problema de contaminación cruzada.

Normas generales en casos especiales

Estas normas generales se completarán con aquellas que son específicas a determinados vestigios orgánicos y a su forma de presentación.

Indicios líquidos. Se deben recoger con una jeringa estéril; la sangre debe mantenerse anticoagulada con EDTA, pero sirve con cualquier otro producto. También se pueden utilizar algodón, gasa, o hisopos estériles, para la recolección, dejándolos secar antes de almacenar.

Indicios húmedos.
Se debe dejarlos secar a temperatura ambiente, sin aplicar ninguna fuente de calor. No deben guardarse en estado húmedo, ya que la humedad favorece el crecimiento de bacterias y hongos que puede afectar a la calidad del indicio (las enzimas restrictoras pueden degradar el DNA de los microorganismos).

Manchas secas. Las podemos encontrar sobre objetos transportables (cuchillo, bolígrafo, armas, elementos de limpieza, etc.) o sobre objetos no transportables (muebles, paredes, sanitarios, etc.). Dentro de los primeros debemos incluir aquellos que se pueden cortar (cortinas, alfombras, etc.). En el caso de que se puedan transportar enviaremos el objeto o el trozo cortado del mismo, excepto si se trata de alguna prenda de vestir que la remitiremos sin cortar. Cuando el objeto no es transportable (suelo, muebles,) procederemos a raspar la mancha con un instrumento estéril o lo mas limpio, depositando el raspado en un papel de similares caracteres, que se doblará e introducirá en un recipiente hermético limpio para mantener el indicio. En el caso de que se localicen pequeñas gotas, como consecuencia de salpicaduras, se debe raspar o tratar de recuperarlas aplicando sobre ellas una cinta adhesiva.

Restos sólidos. Con la misma precaución, procederemos a su recolección y almacenamiento. Cuando sean antiguos podremos tomarlos directamente usando guantes, pero sin son recientes, frágiles o maleables debemos usar pinzas.

Pelos. Siempre se mantendrá el cuidado que las normas generales aconsejan, debiendo ser recogidos con pinzas. Debe evitarse un fallo muy frecuente al manejar pelos, ya que hay que almacenar cada pelo en un recipiente diferente, pese a que aparezcan todos juntos e incluso parezcan, macroscópicamente, proceder de una misma persona.

Un tema aparte los representan los huesos en casos antiguos o identificación de restos con varios años o meses en cualquier medio, agua, tierra o sales de determinados terrenos. También se hace hincapié en dos casos que nos tocan muy de cerca por un lado restos de fosas comunes. En nuestro país luego del último proceso de reorganización nacional. Y un caso especial como fue el último accidente del avión de Lapa en el aeropuesto Jorge Newbery de Capital Federal.

Huesos. Deben ser manipulados con guantes de cirugía para evitar la contaminación con células epitaliales o sudor, como se dijo previamente. En lo posible trabajar con los huesos recientemente desenterrados, sin lavar. El lavado, el secado y posterior almacenamiento estando húmedo puede enmohecerlo y acelerar el proceso de degradación. El exceso de tierra o ceniza se elimina con escalpelo y el hueso se limpia en un chorro abrasivo de arena fresca de óxido de aluminio. Posteriormente, se elimina el polvo del hueso y el óxido de aluminio del hueso limpio utilizando una brocha suave (Hagelberg y Clegg, 1991: 45-46).

Una vez recogido el indicio debe conservarse en frío (+4ºC) o congelarlo a la mínima temperatura posible. Se debe tener en cuenta que al conservar de esta manera, muy posiblemente se invalide las muestras para otros análisis diferentes a la identificación de DNA.

Causas más frecuentes de recusación de la prueba pericial de ADN.

El principal criterio que se debe tener en cuenta es el filogenético. Si la muestra se contaminó con material genético de flora y fauna animal se puede detectar su autenticidad mediante la inspección de las secuencias con especies afines relacionadas. En segundo lugar, el tamaño del producto amplificado puede servir como un criterio adicional de autenticidad. Recientemente se ha comprobado que no es posible amplificar fragmentos de DNA antiguo más allá de 150 bp (base-pair), aunque un hueso bien conservado puede ampliar hasta 500 bp. Estudios realizados en tejido momificado egipcio demuestran que el DNA antiguo se puede conservar en una forma clonable y que tanto el DNA nuclear como el mitocondrial pueden persistir durante varios milenios.

Muestras Contaminadas.

Con el fin de detectar cualquier fuente de contaminación se deben tomar algunas medidas de precaución.
1. Realizar extractos de control en paralelo obtenidos de especimenes antiguos, para detectar contaminación en las soluciones y reactivos.
2. Preparar varios extractos independientes de cada individuo y comparar la identidad y la ausencia de ambigüedad en las secuencias.
3. En virtud de la fuerte correlación inversa entre la eficiencia de la amplificación y el tamaño del producto amplificado observado en el DNA antiguo pero no en el moderno, el tamaño del DNA amplificado puede servir como un criterio adicional de detección de contaminación. Secuencias superiores a 500 bp prueban invariablemente que la muestra se contaminó con DNA de especimenes modernos.

Errores producidos por cambios post mortem

Habitualmente no se espera que predominen los errores específicos producidos por cambios post mortem en una población amplificada de moléculas. Si llegan a predominar y a causar secuencias incorrectas, el patrón de sustitución puede afectarse en un sentido predecible. Las sustituciones pueden estar distribuidas aleatoriamente con relación a las posiciones de los codones, de hecho, no obstante, el índice de cambios silenciosos a cambios por reemplazo al azar pueden ser de 2 a 8.

Secuencias en mosaico vía PCR saltarín.

El PCR saltarín es una propiedad adicional que puede afectar la autenticidad de las secuencias amplificadas. Si las moléculas moldes no abarcan el segmento total definido por el código existente en el extracto antiguo, la amplificación puede comenzar a partir de segmentos más cortos de DNA que son complementarios a uno u otro de los códigos (primers). Esos fragmentos sirven como moldes en la primera extensión y los códigos parcialmente extendidos pueden ser extendidos en el siguiente ciclo después de hibridarse con otros fragmentos de la región que es amplificada. En el caso de genes cromosómicos de individuos heterocigóticos el PCR saltarín puede generar secuencias erróneas que resultan de la recombinación durante la amplificación.

Presentación de las pruebas

Para que un test forense sea admitido como prueba, ha de cumplir tres condiciones:

1. Que la teoría científica en cuestión sea considerada válida por la comunidad científica;
2. La fiabilidad de la prueba debe ser reconocida;
3. Debe demostrarse que ésta se aplicó adecuadamente en el caso concreto.

En Estados Unidos se ha utilizado la prueba de DNA en más de 1.000 casos criminales, pero sólo en unas decenas de casos se le ha cuestionado en audiencias preprocesales. El poder de la identificación forense por DNA radica precisamente, no sólo en la capacidad de demostrar que dos muestras exhiben el mismo patrón, sino también para sugerir que el patrón es rarísimo. En este sentido, la validez de los datos y las hipótesis sobre las que se han basado los laboratorios forenses para estimar la rareza son objeto de debate entre la comunidad científica.

Los mayores problemas en la utilización de las pruebas de DNA radican:

1. En los precios de las pruebas. Sus altos costos, la necesidad de recurrir a laboratorios competentes y en el exterior, los escasos recursos que en los tribunales se asigna a las pruebas periciales y la baja condición socioeconómica de los acusados en su mayoría dificultan su utilización.
2. Para que la prueba tenga una alta confiabilidad se requiere conocer el genoma de la población comparativa. Un estudio de esta magnitud cuesta varios millones de dólares.
3. La incorrecta manipulación de las muestras y las condiciones mismas de su degradación dificultan su utilización.

Por último, la aceptación de estas pruebas depende del conocimiento y características básicas de los test de DNA por parte fiscales, jueces y abogados, para no ser rebasados por la complejidad del tema. En la medida en que se superen estas dificultades, con una regulación y adecuada estructuración de laboratorios forenses, la nueva técnica de tipificación del DNA cumplirá un importante papel en el mejoramiento de las pruebas periciales, base de la justicia moderna.

El ADN y la Investigación Biológica de la Paternidad.

La investigación de la paternidad es un proceso típico del derecho civil que se realiza en Cuba a solicitud de uno de los progenitores para la reclamación de un presunto padre o para tener la certeza de una paternidad por un progenitor, sin embargo también puede ser causa de solicitud para el derecho penal estos son los casos de los delitos sexuales donde la concepción no es deseada y jurídicamente agrava el delito.

Las características de estos hechos y las circunstancias que los rodean (conocimiento entre el agresor y la víctima antes de que ocurrieran los hechos, victimización secundaria, secuelas psíquicas importantes, naturaleza semipública del delito,...) hacen que en no pocos casos, especialmente en los que no ha existido una violencia importante y hay cierto grado de relación entre agresor y víctima, o cuando hay alguna enfermedad mental en esta, la denuncia pueda retrasarse un tiempo considerable respecto a los hechos y sean circunstancias físico-clínicas las que la precipiten. Nos referimos fundamentalmente a cuando se diagnostica alguna enfermedad de transmisión sexual o, sobre todo, cuando se produce un embarazo tras la agresión.

CONCLUSIONES

El desarrollo científico ha permitido la introducción de la tecnología del ADN en la investigación forense, posibilitando el estudio de indicios biológicos mínimos, hecho que unos pocos años atrás era imposible. El Médico Forense se encuentra en una posición privilegiada para recoger algunos vestigios que por su fragilidad pueden alterarse o perderse como consecuencia de una actuación retrasada, permitiendo su estudio y la resolución del caso, con las consecuencias beneficiosas que de ello se derivarían.

Por otra parte, al margen de la profesionalidad y del compromiso deontológico, se está produciendo una exigencia por parte de la sociedad, cada vez más conocedora de la posibilidades técnicas existentes a través de los medios de comunicación, reclamando una responsabilidad profesional del personal encargado del caso, al igual que en otros campos de la Medicina. Así en Estados Unidos se han presentado ya querellas criminales contra hospitales, médicos y cuerpos policiales no federales por mal praxis y negligencia, al no recoger indicios criminales que podrían haber conducido a la identificación del autor de los hechos denunciados (en la mayoría de las reclamaciones admitidas, por defectos en la toma o conservación de supuestos indicios de semen en casos de violación).
E
l estudio del ADN ha supuesto un enorme "paso de gigante" en la identificación médico-forense, tanto en la investigación criminal, como en la investigación biológica de la paternidad. Las especiales circunstancias en las que se desenvuelve la primera de ellas hace que el potencial tecnológico no sea suficiente para la consecución del objetivo si previamente no se ha realizado un buen trabajo por parte del equipo de investigación encabezado por el Médico Forense, que por su formación y especialización es el profesional idóneo para valorar los indicios biológicos.

En los casos en los que haya que recoger las evidencias, debe hacerse en condiciones de máxima limpieza o esterilidad todos los indicios de origen biológico presentes, almacenándolos independientemente y adecuadamente identificados en cuántos recipientes estériles sea necesario y manteniéndolos custodiados en un frigorífico hasta recibir las instrucciones oportunas por parte de las Autoridades Judiciales. Cuando se proceda al envío de las muestras, hay que asegurarse de que no se romperá la "cadena de frío".

Parafraseando a BERTILLON, se puede afirmar que "sólo se recoge lo que se ve, y sólo se ve lo que se tiene en la mente", lo cual exige una formación y conocimiento adecuado del trabajo a realizar.

BIBLIOGRAFÍA.

1. Lorente JA, Lorente M. El ADN y la identificación en la investigacion criminal y en la paternidad biológica. Editorial Comares, 1995.
2. Gill P, Jeffreys AJ, Werret DJ. Forensic application of DNA "finger-prints". Nature 1985; 318: 1111-1126.
3. Gill P, Jeffreys AJ, Werret DJ. Forensic application of DNA "finger-prints". Nature 1985; 318: 1111-1126.
4. Jeffreys AJ, Wilson V, Thein SL. Individual-specific"fingerprints" in human DNA. Nature 1985; 316: 76-79.
5. Oste C. Polymerase chain reaction. Biotechniques 1988; 6: 77-90
6. Hochmeister MN, Budowle B, Borer UV, Eggmann U, Comey CT, Dirnhofer R. Typing of deoxyribonucleic acid (DNA) extracted from compact bone from human remains. J. Forensic Sci. 1991; 36: 1649-1661.
7. Horn GT, Richards B, Klinger KW. Amplification of a highly polymorphic VNTR by the polymerase chain reaction. Nucleic Acids Res. 1989; 17: 2140
8. Villanueva E, Lorente JA. Aplicaciones del DNA a la Medicina Legal. En: Gisbert Calabuig JA, ed. Medicina Legal y Toxicología. Barcelona: Salvat 1990; 1044-1050.
9. Lorente M. Polimorfismo del ADN e identificación médico-legal: Estudio de siete loci mediante la reacción en cadena de la polimerasa (PCR). Tesis Doctoral, 1994.
10. Lorente JA, Lorente M. El ADN y la identificación en la investigacion criminal y en la paternidad biológica. Editorial Comares, 1995.

Autores:

Dr. Ricardo Rodríguez Jorge.

Especialista de ll grado en Medicina Legal.

Dr. José Alberto Borges López.
Especialista de II grado en Medicina Legal.


A continuación, presentamos una selección de los vídeos que ya pueden ver en la sección Vídeos de Medicina y Enfermería

>>ENTRAR EN VÍDEOS DE MEDICINA Y ENFERMERÍA

Categorías

Buscar publicaciones:



 Búsqueda Avanzada



Siga diariamente todas las novedades de PortalesMedicos.com en


  Revista Electrónica de PortalesMedicos.com

Revista de Medicina y Ciencias de la Salud, de periodicidad quincenal, dirigida a los profesionales de la Salud de habla hispana. ISSN 1886-8924